Результаты поиска по книге
Результаты 1 – 3 из 76
Стр.
( A ) Plots illustrating A sequence conservation ( 18 ) across the S - locus region between C24 and Col - 0 ( bottom plot ) and between Cvi - O and Col - 0 ( top plot ) . Cvi vs. Col Colored regions designate the Ubox , YSCR , YSRK ...
( A ) Plots illustrating A sequence conservation ( 18 ) across the S - locus region between C24 and Col - 0 ( bottom plot ) and between Cvi - O and Col - 0 ( top plot ) . Cvi vs. Col Colored regions designate the Ubox , YSCR , YSRK ...
Стр.
( C ) Deoxyribonuclease I footprints across the ORB4 region . DNA sequences are indicated at the side for reference , with the ORB4 sequence boxed . 0.10 ucal / sec 0.05 0.00 0.06 N 0.9 +0.02 Kd 0.54M 0.1 5 ' GCCG TCTCCACAGGAAACGGAGGGGT ...
( C ) Deoxyribonuclease I footprints across the ORB4 region . DNA sequences are indicated at the side for reference , with the ORB4 sequence boxed . 0.10 ucal / sec 0.05 0.00 0.06 N 0.9 +0.02 Kd 0.54M 0.1 5 ' GCCG TCTCCACAGGAAACGGAGGGGT ...
Стр.
The expected end - ofrange damage region occurs 85 nm into the sample . At a depth of 35 nm , there exists a second damage region associated with a high concentration of As atoms . The high - resolution images show that these defects ...
The expected end - ofrange damage region occurs 85 nm into the sample . At a depth of 35 nm , there exists a second damage region associated with a high concentration of As atoms . The high - resolution images show that these defects ...
Отзывы - Написать отзыв
Не удалось найти ни одного отзыва.
Другие издания - Просмотреть все
Часто встречающиеся слова и выражения
action activity addition analysis applications areas ASSISTANT associated atoms binding biology body brain cancer candidates cells Center Chair Chemistry College complex Department direction disease domain E-mail effect electron Employer energy engineering Equal et al expected experience expression faculty field function funding gene genetic genome Health human imaging important increased indicate individuals initial Institute interactions interests Laboratory letters magnetic MANAGER material measured mechanisms Medical Medicine midbrain molecular molecules Nature neurons observed Opportunity organic origin Ph.D physical position present Professor protein reaction recent References region relative reported response Review sample says School Science scientists Search sequence shown social species structure studies successful suggest surface teaching tion Univ University vitae
Библиографические данные
| Название | Science, Том 317,Выпуски 5841-5846 |
| Редактор | John Michels (Journalist) |
| Соавтор | American Association for the Advancement of Science |
| Издатель | American Association for the Advancement of Science, 2007 |
| Владелец оригинала: | Иллинойсский университет в Урбане-Шампейне |
| Оцифровано | 6 ноя 2018 |
| Экспорт цитаты | BiBTeX EndNote RefMan |