Результаты поиска по книге
Результаты 1 – 3 из 81
Стр. 997
See for example , G. J. Quigley and A. Rich , into the reactions that are catalyzed by the TCTAGAGTAGTCCAGGGTTTCCGAGGGTTTCCGTCGACGATGTCAG Science 194 , 796 ( 1976 ) ; A. C. Dock - Bregeon et spliceosome . al . , Nature 335 , 375 ( 1988 ) ...
See for example , G. J. Quigley and A. Rich , into the reactions that are catalyzed by the TCTAGAGTAGTCCAGGGTTTCCGAGGGTTTCCGTCGACGATGTCAG Science 194 , 796 ( 1976 ) ; A. C. Dock - Bregeon et spliceosome . al . , Nature 335 , 375 ( 1988 ) ...
Стр. 1452
F. Hochstenbach and M. B. Brenner , Nature 340 , 562 ( 1989 ) . 20. C. J. Guidos , J. S. Danska , C. G. Fathman , I. L. Weissman , J. Exp . Med . 172 , 835 ( 1990 ) . 21. H. S. Teh et al . , Nature 335 , 229 ( 1988 ) ; L. J. Berg et al ...
F. Hochstenbach and M. B. Brenner , Nature 340 , 562 ( 1989 ) . 20. C. J. Guidos , J. S. Danska , C. G. Fathman , I. L. Weissman , J. Exp . Med . 172 , 835 ( 1990 ) . 21. H. S. Teh et al . , Nature 335 , 229 ( 1988 ) ; L. J. Berg et al ...
Стр. 1790
B. A. Larder , D. J. Purifoy , K. L. Powell , G. Darby , Nature 327 , 716 ( 1987 ) . 12. M. Delarue , V. Pock , N. Tordo , D. Moras , P. Argos , Protein Eng . 3 , 461 ( 1990 ) . 13. P. Argos , Nucl . Acid Res . 16 , 9909 ( 1988 ) . 14.
B. A. Larder , D. J. Purifoy , K. L. Powell , G. Darby , Nature 327 , 716 ( 1987 ) . 12. M. Delarue , V. Pock , N. Tordo , D. Moras , P. Argos , Protein Eng . 3 , 461 ( 1990 ) . 13. P. Argos , Nucl . Acid Res . 16 , 9909 ( 1988 ) . 14.
Отзывы - Написать отзыв
Не удалось найти ни одного отзыва.
Содержание
New Academy Members | 981 |
Looking Glass Chemistry | 987 |
THIS WEEK IN SCIENCE | 1104 |
Авторские права | |
Не показаны другие разделы: 4
Другие издания - Просмотреть все
Часто встречающиеся слова и выражения
acid activity addition analysis applications associated binding biology candidate cells Center Chem chemical chemistry complex concentrations containing Department determined direct Director disease effect electron Employer energy Equal et al experience expression field function funding gene genetic global growth Health human important increase indicated Institute interaction interest Laboratory lane Manager material measured membrane ment molecular Nature nuclear observed Opportunity patients Ph.D physical population position possible present Press problems protein range reaction receptor record references region represent response samples says Science scientific scientists Send sequences specific structure suggest surface temperature tion transfer United University values York